CRISPR
CRISPR1-zgc:153521
- ID
- ZDB-CRISPR-200204-6
- Name
- CRISPR1-zgc:153521
- Previous Names
- None
- Target
-
- zgc:153521 (1)
- Sequence
-
5' - AGAGCAGAACATCATTGACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature | Affected Genomic Regions |
---|---|
a372 | zgc:153521 |
a373 | zgc:153521 |
1 - 2 of 2
Expression
Gene expression in Wild Types + CRISPR1-zgc:153521
No data available
Phenotype
Phenotype resulting from CRISPR1-zgc:153521
No data available
Phenotype of all Fish created by or utilizing CRISPR1-zgc:153521
1 - 5 of 6 Show all
Citations
- Wong, H.H., Seet, S.H., Maier, M., Gurel, A., Traspas, R.M., Lee, C., Zhang, S., Talim, B., Loh, A.Y.T., Chia, C.Y., Teoh, T.S., Sng, D., Rensvold, J., Unal, S., Shishkova, E., Cepni, E., Nathan, F.M., Sirota, F.L., Liang, C., Yarali, N., Simsek-Kiper, P.O., Mitani, T., Ceylaner, S., Arman-Bilir, O., Mbarek, H., Gumruk, F., Efthymiou, S., Uğurlu Çi Men, D., Georgiadou, D., Sotiropoulou, K., Houlden, H., Paul, F., Pehlivan, D., Lainé, C., Chai, G., Ali, N.A., Choo, S.C., Keng, S.S., Boisson, B., Yılmaz, E., Xue, S., Coon, J.J., Ly, T.T.N., Gilani, N., Hasbini, D., Kayserili, H., Zaki, M., Isfort, R.J., Ordonez, N., Tripolszki, K., Bauer, P., Rezaei, N., Seyedpour, S., Khotaei, G.T., Bascom, C.C., Maroofian, R., Chaabouni, M., Alsubhi, A., Eyaid, W., Işıkay, S., Gleeson, J.G., Lupski, J.R., Casanova, J.L., Pagliarini, D.J., Akarsu, N.A., Maurer-Stroh, S., Cetinkaya, A., Bertoli-Avella, A., Mathuru, A.S., Ho, L., Bard, F.A., Reversade, B. (2021) Loss of C2orf69 defines a fatal autoinflammatory syndrome in humans and zebrafish that evokes a glycogen storage-associated mitochondriopathy. American journal of human genetics. 108(7):1301-1317
- Thyme, S.B., Pieper, L.M., Li, E.H., Pandey, S., Wang, Y., Morris, N.S., Sha, C., Choi, J.W., Herrera, K.J., Soucy, E.R., Zimmerman, S., Randlett, O., Greenwood, J., McCarroll, S.A., Schier, A.F. (2019) Phenotypic Landscape of Schizophrenia-Associated Genes Defines Candidates and Their Shared Functions. Cell. 177(2):478-491.e20
1 - 2 of 2
Show