CRISPR

CRISPR1-ciao3

ID
ZDB-CRISPR-200103-1
Name
CRISPR1-ciao3
Previous Names
  • CRISPR1-narfl
  • CRISPR3-ciao3
  • CRISPR3-narfl
Target
Sequence
5' - ATGTTGGCGTCTGCATGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb379 ciao3
Expression
Gene expression in Wild Types + CRISPR1-ciao3
No data available
Phenotype
Phenotype resulting from CRISPR1-ciao3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ciao3
Phenotype Fish Conditions Figures
whole organism kdr expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
intestine fabp1a expression spatial pattern, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism bmp2b expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
aconitate hydratase activity decreased efficacy, abnormal ciao3ihb379/ihb379 standard conditions Fig. 1 from Luo et al., 2019
adenylyl-sulfate reductase (glutathione) activity decreased efficacy, abnormal ciao3ihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
intestine fabp1a expression decreased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism bmp7b expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
superoxide dismutase activity decreased efficacy, abnormal ciao3ihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
whole organism hkdc1 expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
liver ela2l expression spatial pattern, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism hif1ab expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
whole organism gck expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
blood vessel development hypertrophic growth, ameliorated ciao3ihb379/ihb379 chemical treatment: 2-methoxy-17beta-estradiol Fig. 5 from Luo et al., 2019
intestine hif1ab expression increased distribution, abnormal ciao3ihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
digestive system compound organ morphology, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
liver ela2l expression decreased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
exocrine pancreas fabp2 expression decreased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism pdgfrb expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism angpt1 expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism tek expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism vegfab expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism bmp16 expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
glutathione synthase activity decreased efficacy, abnormal ciao3ihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
exocrine pancreas fabp2 expression spatial pattern, abnormal ciao3ihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism aldoca expression increased amount, abnormal ciao3ihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal ciao3ihb379/ihb379; y1Tg standard conditions Fig. 2 from Luo et al., 2019
Citations