CRISPR
CRISPR1-znfl1
- ID
- ZDB-CRISPR-190711-4
- Name
- CRISPR1-znfl1
- Previous Names
-
- CRISPR1-znfl1,znfl1b,znfl1c,znfl1g,znfl1h,znfl1i,znfl1j,znfl1k,znfl1l
- Targets
- Sequence
-
5' - GTTAGTAGCCAAATAAGATTTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "TGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-znfl1
No data available
Phenotype
Phenotype resulting from CRISPR1-znfl1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-znfl1
1 - 5 of 7 Show all
Citations
- Li, J., Gao, F., Zhao, Y., He, L., Huang, Y., Yang, X., Zhou, Y., Yu, L., Zhao, Q., Dong, X. (2018) Zebrafish znfl1s regulate left-right asymmetry patterning through controlling the expression of fgfr1a. Journal of Cellular Physiology. 234(3):1987-1995
- Li, J., Zhao, Y., He, L., Huang, Y., Yang, X., Yu, L., Zhao, Q., Dong, X. (2018) Znfl1s are essential for patterning the anterior-posterior axis of zebrafish posterior hindbrain by acting as direct target genes of retinoic acid. Mechanisms of Development. 155:27-33
- Dong, X., Li, J., He, L., Gu, C., Jia, W., Yue, Y., Li, J., Zhang, Q., Chu, L., Zhao, Q. (2017) Zebrafish Znfl1 proteins control the expression of hoxb1b gene in the posterior neuroectoderm by acting upstream of pou5f3 and sall4 genes.. The Journal of biological chemistry. 292(31):13045-13055
1 - 3 of 3
Show