CRISPR

CRISPR1-scd

ID
ZDB-CRISPR-190116-4
Name
CRISPR1-scd
Previous Names
None
Target
Sequence
5' - GGTGGTCTGGGCATCACTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3016 scd
Expression
Gene expression in Wild Types + CRISPR1-scd
No data available
Phenotype
Phenotype resulting from CRISPR1-scd
No data available
Phenotype of all Fish created by or utilizing CRISPR1-scd
Phenotype Fish Conditions Figures
visceral fat wnt10b expression decreased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat acadl expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
whole organism decreased length, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: unsaturated fatty acid, chemical treatment by diet: oleic acid, chemical treatment by diet: palmitoleic acid Fig. 3 with image from Zhang et al., 2022
whole organism length, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 3 with image from Zhang et al., 2022
trunk increased circumference, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 2 with imageFig. 3 with image from Zhang et al., 2022
visceral fat phyh expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
whole organism increased weight, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 2 with imageFig. 3 with image from Zhang et al., 2022
visceral fat cebpa expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat increased volume, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: saturated fatty acid, chemical treatment by diet: Stearic acid(d3), chemical treatment by diet: Palmitic acid(d3) Fig. 3 with image from Zhang et al., 2022
visceral fat pck1 expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat acadl expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat lpin1a expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat cebpa expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat cebpd expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat pparaa expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat pparab expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat increased volume, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: unsaturated fatty acid, chemical treatment by diet: oleic acid, chemical treatment by diet: palmitoleic acid Fig. 3 with image from Zhang et al., 2022
visceral fat pck1 expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat cebpb expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat phyh expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat fasn expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
whole organism increased weight, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: unsaturated fatty acid, chemical treatment by diet: oleic acid, chemical treatment by diet: palmitoleic acid Fig. 3 with image from Zhang et al., 2022
visceral fat acox1 expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat wnt10b expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat cebpb expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
whole organism decreased length, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 2 with imageFig. 3 with image from Zhang et al., 2022
trunk increased circumference, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: unsaturated fatty acid, chemical treatment by diet: oleic acid, chemical treatment by diet: palmitoleic acid Fig. 3 with image from Zhang et al., 2022
visceral fat cebpd expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat pparab expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat fasn expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat acaa1 expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat sfrp5 expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat pparg expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
whole organism weight, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 3 with image from Zhang et al., 2022
vertebral column decreased length, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 2 with image from Zhang et al., 2022
visceral fat acaca expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat increased volume, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 2 with imageFig. 3 with image from Zhang et al., 2022
visceral fat acaa1 expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat pparg expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat lpin1a expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
trunk increased circumference, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: saturated fatty acid, chemical treatment by diet: Stearic acid(d3), chemical treatment by diet: Palmitic acid(d3) Fig. 3 with image from Zhang et al., 2022
visceral fat sfrp5 expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
visceral fat pparaa expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
whole organism decreased length, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: saturated fatty acid, chemical treatment by diet: Stearic acid(d3), chemical treatment by diet: Palmitic acid(d3) Fig. 3 with image from Zhang et al., 2022
visceral fat acaca expression increased amount, abnormal scdzf3016/zf3016 (AB) standard conditions Fig. 6 with image from Zhang et al., 2022
visceral fat volume, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 3 with image from Zhang et al., 2022
visceral fat acox1 expression amount, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 6 with image from Zhang et al., 2022
trunk circumference, ameliorated scdzf3016/zf3016 (AB) chemical treatment by diet: polyunsaturated fatty acid, chemical treatment by diet: EPA (d5), chemical treatment by diet: docosahexaenoic acid Fig. 3 with image from Zhang et al., 2022
whole organism increased weight, abnormal scdzf3016/zf3016 (AB) chemical treatment by diet: saturated fatty acid, chemical treatment by diet: Stearic acid(d3), chemical treatment by diet: Palmitic acid(d3) Fig. 3 with image from Zhang et al., 2022
liver increased size, ameliorated scdzf3016/+; gz32Tg; zf3013Tg; zf3014Tg chemical treatment by environment: doxycycline Fig. 5 from Yao et al., 2018
liver increased size, ameliorated scdzf3016/+; gz26Tg; gz32Tg; zf3013Tg chemical treatment by environment: doxycycline Fig. 5 from Yao et al., 2018
Citations