CRISPR
CRISPR1-gdf11
- ID
- ZDB-CRISPR-181119-88
- Name
- CRISPR1-gdf11
- Previous Names
-
- Z001507 (1)
- Target
- Sequence
-
5' - GGTGGTGGCGTGATACTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "CGG" at the 3' end.
- Genome Resources
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-gdf11
No data available
Phenotype
Phenotype resulting from CRISPR1-gdf11
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gdf11
1 - 5 of 8 Show all
Citations
- Ravenscroft, T.A., Phillips, J.B., Fieg, E., Bajikar, S.S., Peirce, J., Wegner, J., Luna, A.A., Fox, E.J., Yan, Y.L., Rosenfeld, J.A., Zirin, J., Kanca, O., Undiagnosed Diseases Network, Benke, P.J., Cameron, E.S., Strehlow, V., Platzer, K., Jamra, R.A., Klöckner, C., Osmond, M., Licata, T., Rojas, S., Dyment, D., Chong, J.S.C., Lincoln, S., Stoler, J.M., Postlethwait, J.H., Wangler, M.F., Yamamoto, S., Krier, J., Westerfield, M., Bellen, H.J. (2021) Heterozygous loss-of-function variants significantly expand the phenotypes associated with loss of GDF11. Genetics in medicine : official journal of the American College of Medical Genetics. 23(10):1889-1900
- Pei, W., Xu, L., Huang, S.C., Pettie, K., Idol, J., Rissone, A., Jimenez, E., Sinclair, J.W., Slevin, C., Varshney, G.K., Jones, M., Carrington, B., Bishop, K., Huang, H., Sood, R., Lin, S., Burgess, S.M. (2018) Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues. NPJ Regenerative medicine. 3:11
1 - 2 of 2
Show