CRISPR

CRISPR4-eys

ID
ZDB-CRISPR-181029-1
Name
CRISPR4-eys
Previous Names
None
Target
Sequence
5' - GGTGCAGGAAAACTCCCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
rmc101 eys
Expression
Gene expression in Wild Types + CRISPR4-eys
No data available
Phenotype
Phenotype resulting from CRISPR4-eys
No data available
Phenotype of all Fish created by or utilizing CRISPR4-eys
Phenotype Fish Conditions Figures
retina detection of light stimulus involved in visual perception decreased process quality, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 3 with image from Messchaert et al., 2018
retinal outer nuclear layer decreased thickness, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. S3 with image from Messchaert et al., 2018
eye photoreceptor cell eys expression absent, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
photoreceptor inner segment layer rho expression mislocalised, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
eye photoreceptor cell synapse rho expression mislocalised, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
photoreceptor outer segment layer disorganized, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
embryonic retina morphogenesis in camera-type eye decreased process quality, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
eye photoreceptor cell synapse ab2-gnat2 labeling mislocalised, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
photoreceptor cell outer segment organization decreased process quality, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
retinal inner nuclear layer decreased thickness, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. S3 with image from Messchaert et al., 2018
photoreceptor inner segment layer ab2-gnat2 labeling mislocalised, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
visual behavior decreased process quality, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 4 with image from Messchaert et al., 2018
eye photoreceptor cell photoreceptor outer segment malformed, abnormal eysrmc101/rmc101 (TL) standard conditions Fig. 2 with image from Messchaert et al., 2018
Citations