CRISPR

CRISPR1-rb1

ID
ZDB-CRISPR-181019-4
Name
CRISPR1-rb1
Previous Names
None
Target
Sequence
5' - GGAGAGGGAGATCAGATCGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
is21Tg rb1
is59Tg rb1
Expression
Gene expression in Wild Types + CRISPR1-rb1
Expressed Gene Anatomy Figures
ascl1b Fig. 4 from Schultz et al., 2018
hdac1 Fig. 4 from Schultz et al., 2018
olig2 Fig. 4 from Schultz et al., 2018
rbbp4 Fig. 4 from Schultz et al., 2018
Phenotype
Phenotype resulting from CRISPR1-rb1
Phenotype Fish Figures
brain ab18-h3 labeling increased amount, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain rbbp4 expression increased amount, abnormal WT + CRISPR1-rb1 Fig. 4 from Schultz et al., 2018
brain hdac1 expression increased amount, abnormal WT + CRISPR1-rb1 Fig. 4 from Schultz et al., 2018
brain Ab2-olig2 labeling increased amount, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain ascl1b expression increased amount, abnormal WT + CRISPR1-rb1 Fig. 4 from Schultz et al., 2018
brain olig2 expression increased amount, abnormal WT + CRISPR1-rb1 Fig. 4 from Schultz et al., 2018
brain ab1-sox2 labeling increased amount, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain ab3-sox10 labeling increased amount, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain Ab2-olig2 labeling increased distribution, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain ab1-sox2 labeling increased distribution, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain ab3-sox10 labeling increased distribution, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
brain mitotic cell cycle increased occurrence, abnormal kca66Tg + CRISPR1-rb1 Fig. 6 with image from Schultz et al., 2018
hindbrain neoplastic, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
midbrain neoplastic, abnormal WT + CRISPR1-rb1 Fig. 1 with image from Schultz et al., 2018
Phenotype of all Fish created by or utilizing CRISPR1-rb1
Phenotype Fish Conditions Figures
brain ab3-sox10 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
hindbrain neoplastic, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ab18-h3 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain Ab2-olig2 labeling increased distribution, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ab3-sox10 labeling increased distribution, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ab1-sox2 labeling increased distribution, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain Ab2-olig2 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ascl1b expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
midbrain neoplastic, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain rbbp4 expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
brain hdac1 expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
brain ab1-sox2 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain olig2 expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
brain mitotic cell cycle increased occurrence, abnormal kca6Tg + CRISPR1-rb1 control Fig. 6 with image from Schultz et al., 2018
brain mitotic cell cycle increased occurrence, abnormal kca66Tg + CRISPR1-rb1 control Fig. 6 with image from Schultz et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.