CRISPR

CRISPR1-ahr2

ID

ZDB-CRISPR-180726-34

Name

CRISPR1-ahr2

Previous Names

None

Target

ahr2 (1)

Sequence

5' - GTACATATGCGGTCAAGAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
osu1	ahr2

Expression

Gene expression in Wild Types + CRISPR1-ahr2

No data available

Phenotype

Phenotype resulting from CRISPR1-ahr2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ahr2

Phenotype	Fish	Conditions	Figures
whole organism wfikkn1 expression amount, ameliorated	ahr2^osu1/osu1	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 2 from Shankar et al., 2022
whole organism decreased fertility, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 4 from Garcia et al., 2018
frontal bone morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
supraorbital bone morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
caudal fin morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
ovarian follicle stage IV decreased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 4 from Garcia et al., 2018
ovarian follicle stage III increased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 4 from Garcia et al., 2018
whole organism ahrrb expression increased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 3 from Garcia et al., 2018
opercular flap morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
ovarian follicle stage IV degenerate, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 4 from Garcia et al., 2018
visual behavior process quality, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 6 from Garcia et al., 2018
whole organism cyp1b1 expression increased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 3 from Garcia et al., 2018
whole organism cyp1c1 expression increased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 3 from Garcia et al., 2018
anal fin morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
mandibular arch skeleton malformed, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
dorsal fin morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018
whole organism ahrra expression increased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 3 from Garcia et al., 2018
whole organism cyp1a expression increased amount, abnormal	ahr2^osu1/osu1 (SPF 5-D)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 3 from Garcia et al., 2018
female organism decreased fecundity, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 4 from Garcia et al., 2018
startle response process quality, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 6 from Garcia et al., 2018
dentary morphology, abnormal	ahr2^osu1/osu1 (SPF 5-D)	standard conditions	Fig. 5 from Garcia et al., 2018

Citations