CRISPR

CRISPR1-smyd1a

ID
ZDB-CRISPR-180503-3
Name
CRISPR1-smyd1a
Previous Names
None
Target
Sequence
5' - GGACCTGAAGGAGCTCAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mb4 smyd1a
mb5 smyd1a
Expression
Gene expression in Wild Types + CRISPR1-smyd1a
No data available
Phenotype
Phenotype resulting from CRISPR1-smyd1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-smyd1a
Phenotype Fish Conditions Figures
somite smyd1a expression decreased amount, abnormal smyd1amb4/mb4 standard conditions Fig. 7 from Cai et al., 2019
somite smyd1a expression decreased amount, abnormal smyd1amb5/mb5 standard conditions Fig. 7 from Cai et al., 2019
whole organism smyd1a expression decreased amount, abnormal smyd1amb5/mb5 standard conditions Fig. 7 from Cai et al., 2019
whole organism hsp90aa1.1 expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
fast muscle cell sarcomere disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11Fig. 12 from Cai et al., 2019
whole organism dnaja expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
slow muscle cell myosin filament decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell myosin filament disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 10 from Cai et al., 2019
adaxial cell ab-f59 labeling decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 13 from Cai et al., 2019
fast muscle cell Z disc decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
fast muscle cell myosin filament ab-mf20 labeling decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
slow muscle cell sarcomere morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 10 from Cai et al., 2019
somite hsp90aa1.1 expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
fast muscle cell myosin filament decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11Fig. 12 from Cai et al., 2019
fast muscle cell sarcomere morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11Fig. 12 from Cai et al., 2019
fast muscle cell M band ab1-myom labeling decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
fast muscle cell myosin filament disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
fast muscle cell M band disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
somite dnaja expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
fast muscle cell Z disc disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
fast muscle cell morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
fast muscle cell M band decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11Fig. 12 from Cai et al., 2019
slow muscle cell morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell M band decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell sarcomere morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell M band mRFP1 expression decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
Citations