CRISPR

CRISPR1-prmt5

ID
ZDB-CRISPR-180319-4
Name
CRISPR1-prmt5
Previous Names
None
Target
Sequence
5' - CTTTGATTTCCTGTGTATGCCGCTGTTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb1994 prmt5
ihb1995 prmt5
Expression
Gene expression in Wild Types + CRISPR1-prmt5
No data available
Phenotype
Phenotype resulting from CRISPR1-prmt5
No data available
Phenotype of all Fish created by or utilizing CRISPR1-prmt5
Phenotype Fish Conditions Figures
whole organism viability, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 1 with image from Zhu et al., 2019
spermatogonium absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with image from Zhu et al., 2019
female organism ratio male organism, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 1 with imageFig. S3 with image from Zhu et al., 2019
testis peptidyl-arginine methylation, to symmetrical-dimethyl arginine disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
testis obsolete histone arginine N-methyltransferase activity disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
testis apoptotic chromosome condensation increased occurrence, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
spermatid absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with imageFig. 8 with image from Zhu et al., 2019
testis atrophied, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 1 with imageFig. S3 with image from Zhu et al., 2019
primordial germ cell decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 3 with image from Zhu et al., 2019
ovarian follicle atresia increased occurrence, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with image from Zhu et al., 2019
gonad apoptotic, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 4 with image from Zhu et al., 2019
primordial germ cell ddx4 expression mislocalised, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 3 with image from Zhu et al., 2019
spermatogenic cyst absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with image from Zhu et al., 2019
gonad ddx4 expression decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 3 with image from Zhu et al., 2019
immature gonad apoptotic chromosome condensation increased occurrence, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with image from Zhu et al., 2019
Sertoli cell increased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
seminiferous tubule increased size, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
spermatogonium absence due to degeneration, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
testis Ab1-sDMA labeling absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 7 with imagetext only from Zhu et al., 2019
testis piwil1 expression decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions text only from Zhu et al., 2019
male organism decreased fecundity, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 1 with image from Zhu et al., 2019
Sertoli cell present, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with image from Zhu et al., 2019
sex determination disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. S3 with image from Zhu et al., 2019
germ cell migration disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 3 with image from Zhu et al., 2019
female organism absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 1 with imageFig. S3 with image from Zhu et al., 2019
female sex differentiation disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 1 with imageFig. S3 with image from Zhu et al., 2019
testis ddx4 expression decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions text only from Zhu et al., 2019
spermatocyte absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 2 with image from Zhu et al., 2019
primordial germ cell ddx4 expression decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 3 with image from Zhu et al., 2019
testis histone H4R3 methyltransferase activity disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with image from Zhu et al., 2019
testis prmt5 expression absent, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 7 with imagetext only from Zhu et al., 2019
peptidyl-arginine methylation disrupted, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions text only from Zhu et al., 2019
testis piwil2 expression decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions text only from Zhu et al., 2019
gonad sycp3 expression decreased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 3 with image from Zhu et al., 2019
Leydig cell increased amount, abnormal prmt5ihb1994/ihb1994 (AB) standard conditions Fig. 8 with imageFig. S3 with image from Zhu et al., 2019
testis piwil1 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad cyp19a1a expression increased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
testis ddx4 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad dnd1 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
gonad cyp11c1 expression increased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad amh expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
testis sycp3 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad cyp19a1a expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
gonad sycp3 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
testis dnd1 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad amh expression increased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
testis cyp19a1a expression increased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
testis amh expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad cyp11c1 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
gonad piwil1 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
testis sox9a expression increased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions text only from Zhu et al., 2019
gonad ddx4 expression decreased amount, abnormal prmt5ihb1994/+; prmt5ihb1995/+ (AB) standard conditions Fig. S3 with imagetext only from Zhu et al., 2019
Citations