CRISPR

CRISPR2-narfl

ID
ZDB-CRISPR-170609-8
Name
CRISPR2-narfl
Previous Names
None
Target
Sequence
5' - GGACATGCAGACGCCAACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb166 ciao3
Expression
Gene expression in Wild Types + CRISPR2-narfl
No data available
Phenotype
Phenotype resulting from CRISPR2-narfl
No data available
Phenotype of all Fish created by or utilizing CRISPR2-narfl
Phenotype Fish Conditions Figures
intestine fabp1a expression spatial pattern, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
whole organism bmp16 expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
liver ela2l expression decreased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
whole organism kdr expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
whole organism pdgfrb expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
intestine fabp1a expression decreased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
whole organism aldoca expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
whole organism vegfab expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
whole organism bmp7b expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
superoxide dismutase activity decreased efficacy, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 from Luo et al., 2019
digestive system compound organ morphology, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
liver ela2l expression spatial pattern, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
glutathione synthase activity decreased efficacy, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
whole organism tek expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
aconitate hydratase activity decreased efficacy, abnormal ciao3ihb166/ihb166 standard conditions Fig. 1 from Luo et al., 2019
blood vessel development hypertrophic growth, ameliorated ciao3ihb166/ihb166 chemical treatment: 2-methoxy-17beta-estradiol Fig. 5 from Luo et al., 2019
whole organism angpt1 expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
whole organism bmp2b expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
adenylyl-sulfate reductase (glutathione) activity decreased efficacy, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 from Luo et al., 2019
whole organism hkdc1 expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
exocrine pancreas fabp2 expression decreased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
subintestinal vein morphology, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 with image from Liu et al., 2017
exocrine pancreas fabp2 expression spatial pattern, abnormal ciao3ihb166/ihb166 standard conditions Fig. 3 from Luo et al., 2019
intestine hif1ab expression increased distribution, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 from Luo et al., 2019
subintestinal vein sprouting angiogenesis increased occurrence, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 with image from Liu et al., 2017
whole organism hif1ab expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 4 from Luo et al., 2019
whole organism gck expression increased amount, abnormal ciao3ihb166/ihb166 standard conditions Fig. 5 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal ciao3ihb166/ihb166; y1Tg standard conditions Fig. 2 from Luo et al., 2019
Citations