CRISPR
CRISPR2-zic1
- ID
- ZDB-CRISPR-161214-100
- Name
- CRISPR2-zic1
- Previous Names
-
- Z000580 (1)
- Target
- Sequence
-
5' - GGGAAGAGTGCGGCCGGGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR2-zic1
No data available
Phenotype
Phenotype resulting from CRISPR2-zic1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-zic1
from 1 - 5 of 13 Show all
Citations
- Medina-Gomez, C., Mullin, B.H., Chesi, A., Prijatelj, V., Kemp, J.P., Shochat-Carvalho, C., Trajanoska, K., Wang, C., Joro, R., Evans, T.E., Schraut, K.E., Li-Gao, R., Ahluwalia, T.S., Zillikens, M.C., Zhu, K., Mook-Kanamori, D.O., Evans, D.S., Nethander, M., Knol, M.J., Thorleifsson, G., Prokic, I., Zemel, B., Broer, L., McGuigan, F.E., van Schoor, N.M., Reppe, S., Pawlak, M.A., Ralston, S.H., van der Velde, N., Lorentzon, M., Stefansson, K., Adams, H.H.H., Wilson, S.G., Ikram, M.A., Walsh, J.P., Lakka, T.A., Gautvik, K.M., Wilson, J.F., Orwoll, E.S., van Duijn, C.M., Bønnelykke, K., Uitterlinden, A.G., Styrkársdóttir, U., Akesson, K.E., Spector, T.D., Tobias, J.H., Ohlsson, C., Felix, J.F., Bisgaard, H., Grant, S.F.A., Richards, J.B., Evans, D.M., van der Eerden, B., van de Peppel, J., Ackert-Bicknell, C., Karasik, D., Kague, E., Rivadeneira, F. (2023) Bone mineral density loci specific to the skull portray potential pleiotropic effects on craniosynostosis. Communications biology. 6:691691
- Moreno-Mateos, M.A., Vejnar, C.E., Beaudoin, J.D., Fernandez, J.P., Mis, E.K., Khokha, M.K., Giraldez, A.J. (2015) CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature Methods. 12:982-8
1 - 2 of 2
Show