CRISPR
CRISPR2-tph1a
- ID
- ZDB-CRISPR-160128-324
- Name
- CRISPR2-tph1a
- Previous Names
-
- Z000426 (1)
- Target
- Sequence
-
5' - GGGAAAACACAACCGCAGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "CGG" at the 3' end.
- Genome Resources
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR2-tph1a
No data available
Phenotype
Phenotype resulting from CRISPR2-tph1a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tph1a
1 - 5 of 20 Show all
Citations
- Pan, Y.K., Jensen, G., Perry, S.F. (2020) Disruption of tph1 genes demonstrates the importance of serotonin in regulating ventilation in larval zebrafish (Danio rerio). Respiratory Physiology & Neurobiology. 285:103594
- Zimmer, A.M., Do, J., Szederkenyi, K., Chen, A., Morgan, A.L.R., Jensen, G., Pan, Y.K., Gilmour, K.M., Perry, S.F. (2019) Use of gene knockout to examine serotonergic control of ion uptake in zebrafish reveals the importance of controlling for genetic background: A cautionary tale. Comparative biochemistry and physiology. Part A, Molecular & integrative physiology. 238:110558
- Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T., Yeh, J.R., and Joung, J.K. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol.. 31(3):227-229
1 - 3 of 3
Show