CRISPR
CRISPR1-junbb
- ID
- ZDB-CRISPR-160126-2
- Name
- CRISPR1-junbb
- Previous Names
-
- Z000057 (1)
- Target
- Sequence
-
5' - GGGTTACGGTCACAACGACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-junbb
No data available
Phenotype
Phenotype resulting from CRISPR1-junbb
1 - 4 of 4
Phenotype of all Fish created by or utilizing CRISPR1-junbb
1 - 5 of 23 Show all
Citations
- Klatt Shaw, D., Mokalled, M.H. (2021) Efficient CRISPR/Cas9 mutagenesis for neurobehavioral screening in adult zebrafish. G3 (Bethesda). 11(8):
- Klatt Shaw, D., Saraswathy, V.M., Zhou, L., McAdow, A.R., Burris, B., Butka, E., Morris, S.A., Dietmann, S., Mokalled, M.H. (2021) Localized EMT reprograms glial progenitors to promote spinal cord repair. Developmental Cell. 56(5):613-626.e7
- Kiesow, K., Bennewitz, K., Miranda, L.G., Stoll, S.J., Hartenstein, B., Angel, P., Kroll, J., Schorpp-Kistner, M. (2015) Junb controls lymphatic vascular development in zebrafish via miR-182. Scientific Reports. 5:15007
- Varshney, G.K., Pei, W., LaFave, M.C., Idol, J., Xu, L., Gallardo, V., Carrington, B., Bishop, K., Jones, M., Li, M., Harper, U., Huang, S.C., Prakash, A., Chen, W., Sood, R., Ledin, J., Burgess, S.M. (2015) High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome research. 25(7):1030-42
1 - 4 of 4
Show