CRISPR
CRISPR1-tyr
- ID
- ZDB-CRISPR-131118-1
- Name
- CRISPR1-tyr
- Previous Names
- Target
- Sequence
-
5' - GGACTGGAGGACTTCTGGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
Target Location
Constructs
- Tg(hsp70l:LOXP-DsRed-LOXP-Cas9,rnu6-32:CRISPR1-tyr)
- Tg(rnu6-32:CRISPR1-tyr,cryaa:Cerulean)
- Tg(rnu6-32:CRISPR1-tyr,rnu6-32:CRISPR1-insra,rnu6-14:CRISPR2-insra,rnu6-7:CRISPR1-insrb,rnu6-279:CRISPR2-insrb,cryaa:Cerulean)
- Tg(U6:CRISPR1-tyr,myl7:mCherry)
- Tg(UAS:zCas9-2A-EGFP,rnu6-4:CRISPR1-tyr,rnu6-4:CRISPR3-tyr)
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-tyr
No data available
Phenotype
Phenotype resulting from CRISPR1-tyr
1 - 2 of 2
Phenotype of all Fish created by or utilizing CRISPR1-tyr
1 - 5 of 10 Show all
Citations
- Krueger, C.J., Dai, Z., Zhu, C., Zhang, B. (2024) Heritable CRISPR Mutagenesis of Essential Maternal Effect Genes as a Simple Tool for Sustained Population Suppression of Invasive Species in a Zebrafish Model. Zebrafish. 21(4):279-286
- Locubiche, S., Ordóñez, V., Abad, E., Scotto di Mase, M., Di Donato, V., De Santis, F. (2024) A Zebrafish-Based Platform for High-Throughput Epilepsy Modeling and Drug Screening in F0. International Journal of Molecular Sciences. 25(5):
- Ma, J., Zhang, W., Rahimialiabadi, S., Ganesh, N.U., Sun, Z., Parvez, S., Peterson, R.T., Yeh, J.J. (2024) Instantaneous visual genotyping and facile site-specific transgenesis via CRISPR-Cas9 and phiC31 integrase. Biology Open. 13(9):
- Mori, Y., Smith, S., Wang, J., Eliora, N., Heikes, K.L., Munjal, A. (2024) Versican controlled by Lmx1b regulates hyaluronate density and hydration for semicircular canal morphogenesis. Development (Cambridge, England). 152(1):
- Noonan, H.R., Thornock, A.M., Barbano, J., Xifaras, M.E., Baron, C.S., Yang, S., Koczirka, K., McConnell, A.M., Zon, L.I. (2024) A chronic signaling TGFb zebrafish reporter identifies immune response in melanoma. eLIFE. 13:
- Ye, X., Lin, J., Chen, Q., Lv, J., Liu, C., Wang, Y., Wang, S., Wen, X., Lin, F. (2024) An Efficient Vector-Based CRISPR/Cas9 System in Zebrafish Cell Line. Marine biotechnology (New York, N.Y.). 26(3):588-598
- Kamimoto, K., Stringa, B., Hoffmann, C.M., Jindal, K., Solnica-Krezel, L., Morris, S.A. (2023) Dissecting cell identity via network inference and in silico gene perturbation. Nature. 614(7949):742-751
- Maili, L., Tandon, B., Yuan, Q., Menezes, S., Chiu, F., Hashmi, S.S., Letra, A., Eisenhoffer, G.T., Hecht, J.T. (2023) Disruption of fos causes craniofacial anomalies in developing zebrafish. Frontiers in cell and developmental biology. 11:11418931141893
- Wang, X., Zhu, J., Wang, H., Deng, W., Jiao, S., Wang, Y., He, M., Zhang, F., Liu, T., Hao, Y., Ye, D., Sun, Y. (2023) Induced formation of primordial germ cells from zebrafish blastomeres by germplasm factors. Nature communications. 14:79187918
- Dixon, S.C., Calder, B.J., Lilya, S.M., Davies, B.M., Martin, A., Peterson, M., Hansen, J.M., Suli, A. (2022) Valproic acid affects neurogenesis during early optic tectum development in zebrafish. Biology Open. 12(1):
1 - 10 of 42
Show