cDNA
MGC:113034
- ID
- ZDB-CDNA-050522-509
- Name
- MGC:113034
- Symbol
- MGC:113034
- Previous Names
- 
    
        
    
    
        
        - FR_9356 (1)
 
- Type
- cDNA
- Location
- Unmapped
- Genome Resources
- None
- Species
- Danio rerio
- Library
- GISZF001_ra
- Digest
- Insert Size
- 3285
- Cloning Site
- Sfi A - Sfi B
- Vector Type
- plasmid
- Vector
- pDNR-LIB
- Polymerase
- T3 RNA polymerase
- PCR Amplification
- 
    
        Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
 5' TGGATAACCGTATTACCGCC 3'
 5' CGCGCAATTAACCCTCACTAAAGCACTAGTCATACCAGGATC 3'
- Suppliers
- None
- Protocol
- Thisse in situ hybridization protocol
- Note
- None
                
                    
                        Gene Expression
                    
                    
                
                
            
        
        
    
        
            
               
- Directly Submitted Expression Data
- 1 figure (1 image) from Thisse et al., 2004 [MGC:113034]
                
                    
                        Marker Relationships
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    
                
                    
                        Sequences
                    
                    
                
                
            
        
        
    
        
            
            
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    