cDNA

MGC:113339

ID
ZDB-CDNA-050410-7
Name
MGC:113339
Symbol
MGC:113339
Previous Names
None
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
GISZF001_ra
Digest
Insert Size
500
Cloning Site
EcoRI
Vector Type
plasmid
Vector
pDNR-LIB
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
7 figures (7 images) from Thisse et al., 2008 [MGC:113339]
Marker Relationships
Sequences
Citations