cDNA

MGC:103631

ID
ZDB-CDNA-041114-63
Name
MGC:103631
Symbol
MGC:103631
Previous Names
  • FR_7827 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_19
Digest
Insert Size
520
Cloning Site
EcoRI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Simple to use, intense expression pattern restricted to a few structures )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
7 figures (20 images) from Thisse et al., 2004 [MGC:103631] 8 figures (26 images) from Thisse et al., 2008 [MGC:103631]
Marker Relationships
Sequences
Citations