cDNA

MGC:92355

ID
ZDB-CDNA-041114-180
Name
MGC:92355
Symbol
MGC:92355
Previous Names
None
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_7
Digest
Insert Size
1300
Cloning Site
EcoRI - XhoI
Vector Type
Plasmid
Vector
pExpress-1
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Weak expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (9 images) from Thisse et al., 2008 [MGC:92355]
Marker Relationships
Sequences
Citations