cDNA

MGC:100991

ID
ZDB-CDNA-040801-137
Name
MGC:100991
Symbol
MGC:100991
Previous Names
None
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
GISZF001_ra
Digest
Insert Size
320
Cloning Site
EcoRI
Vector Type
plasmid
Vector
pDNR-LIB
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Simple to use, intense expression pattern restricted to a few structures )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (31 images) from Thisse et al., 2008 [MGC:100991]
Marker Relationships
Sequences
Citations