cDNA

MGC:92742

ID
ZDB-CDNA-040718-344
Name
MGC:92742
Symbol
MGC:92742
Previous Names
None
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_8
Digest
Insert Size
500
Cloning Site
EcoRI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Moderate expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
7 figures (10 images) from Thisse et al., 2008 [MGC:92742]
Marker Relationships
Sequences
Citations