cDNA
MGC:85603
- ID
- ZDB-CDNA-040425-3030
- Name
- MGC:85603
- Symbol
- MGC:85603
- Previous Names
- 
    
        
    
    
        
        - FR_7011 (1)
 
- Type
- cDNA
- Location
- Unmapped
- Genome Resources
- None
- Species
- Danio rerio
- Library
- NCI_CGAP_ZEmb2
- Digest
- Insert Size
- 2653
- Cloning Site
- NotI-SmaI
- Vector Type
- phagemid
- Vector
- pCMV-SPORT6.1
- Polymerase
- T7 RNA polymerase
- PCR Amplification
- 
    
        Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
 5' AACAGCTATGACCATGATTAC 3'
 5' GTAAAACGACGGCCAGT 3'
- Suppliers
- None
- Quality
- ( Moderate expression pattern )
- Protocol
- Thisse in situ hybridization protocol
- Note
- None
                
                    
                        Gene Expression
                    
                    
                
                
            
        
        
    
        
            
               
- Directly Submitted Expression Data
- 6 figures (20 images) from Thisse et al., 2004 [MGC:85603]
                
                    
                        Marker Relationships
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    
                
                    
                        Sequences
                    
                    
                
                
            
        
        
    
        
            
            
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    