cDNA

MGC:65854

ID
ZDB-CDNA-040425-2372
Name
MGC:65854
Symbol
MGC:65854
Previous Names
None
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NCI_CGAP_ZEmb3
Digest
Insert Size
1000
Cloning Site
Vector Type
phagemid
Vector
pCMV-SPORT6.1
Polymerase
T3 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Nice strong expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
8 figures (30 images) from Thisse et al., 2008 [MGC:65854]
Marker Relationships
Sequences
Citations