cDNA

MGC:56355

ID
ZDB-CDNA-040425-1924
Name
MGC:56355
Symbol
MGC:56355
Previous Names
  • FR4947 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
Sugano SJD adult male
Digest
Insert Size
1210
Cloning Site
EcoRI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Protocol
Thisse in situ hybridization protocol
Note
zgc:56355, mRNA (cDNA clone MGC:56355 ) Data published in: Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, EscrivĂ  H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V. Unexpected Novel Relational Links Uncovered by Extensive Developmental Profiling of Nuclear Receptor Expression. PLoS Genet. 2007 Nov 9;3(11):e188.
Gene Expression
Directly Submitted Expression Data
1 figure (1 image) from Thisse et al., 2004 [MGC:56355] 7 figures (7 images) from Thisse et al., 2008 [MGC:56355]
Marker Relationships
Sequences
Citations