cDNA

MGC:77259

ID
ZDB-CDNA-040425-1289
Name
MGC:77259
Symbol
MGC:77259
Previous Names
None
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NCI_CGAP_ZEmb2
Digest
Insert Size
650
Cloning Site
XhoI - HindIII
Vector Type
phagemid
Vector
pCMV-SPORT6.1
Polymerase
T7 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Probe is difficult to use. Generally basal level of expression with more intense labeling in particular structure. )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (8 images) from Thisse et al., 2008 [MGC:77259]
Marker Relationships
Sequences
Citations