Genomic Feature
c144
- ID
- ZDB-ALT-070117-1
- Name
- c144
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation (1)
- Protocol
- adult males treated with ENU
- Lab of Origin
- Halpern Lab
- Current Source
- Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 15: 27367533 (GRCz11) (1) Details
- Nucleotide change
- T/A
- Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- T>A (1)
- Transcript Consequence
- Premature Stop (1)
- Protein Consequence
- None
- Flanking Sequence
-
CATGCATGGCATAACCATTTGATATTTGTACAGTAAAATAGAAATTTAATAAATGTATATTATCTGCTCATCACCTTTTTACTTAATCCGTACAATTAAGTAACTCTTATTAGATTTCTTCTTGAGATTTAATTTAATGTTATATTGAAAGCGCCACAAAATTAGTCGTGTTGCATGTCCGCATGACTGGTTTGTTTCTTTCCACCGGCATAGGCCTGCAGCTCTGTGATTTAACCCAAGAACAATATTTCCACTATTAATTAATATATAATGCGGTTTTATCGTCTAAAACTATTTTAAAGAGTAATGACTTGAAATGTATAATTATTGTGACGAGCACTAATGTCTTCCTCTCCTTCTTAACAGACCATCCTGAATTCAATGCATAAATATCAGCCCAGGTTCCATATTGTGAGAGCCAACGATATTCTGAAGCTTCCGTACAGCACTTTCAGGACATACGTTTTCCCTGAGACCGATTTTATTGCTGTCACTGCTTA
T/A CAAAACGACAAGGTATGTACCCATATTTTGGTAAATTAAAGCGATTTATTAGACATTACAGACATGTGCTTGCATATCTAAATAATGCACAACTTGACTATTCGTAATTTGTGCATATCTACTTTCGTTCTGCGATGCTTTTTGCATGCGATCTACGAGCCTGTACATTTGGTGGGATTTACTGTTTGTCCCTTGGTATAAAAAAGTAGCATAAGTGACAGTATTTTGAATATATGGATGTTAAATTTTATCTTGAAAATTGTTCAAATTCCTCACGTGTCCAGTGCTACTTTCAGCTACTGCTCATGTTAATTGTCGTCTGTGTCCGAGGGGCCTGGTGAGCTTGTCGGTATCGTAAAGTTTATGACATAGAGTCACAATCGATTAGCAGGCACTTAAGCTCGTCGGTTTGTCCGGGAGCAACACACACTGAGGCACAGCAATCAAAGCGTGTCAGTTTCTAAACGCAAAAAGCAGAGGCCATCTAGCTTAGCAATCTC - Additional Sequence
- None
Fish
| Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
|---|---|---|---|---|---|
| tbx2bc144/c144 | Homozygous | Unknown | 2 figures  from 2 publications | 2 figures from Snelson et al., 2008 | |
| tbx2bc144/c144 | Homozygous | ♀+/- ♂+/- | 6 figures from 4 publications | 4 figures from 2 publications | |
| tbx2bc144/c144 (AB) | Homozygous | ♀+/- ♂+/- | 3 figures from Snelson et al., 2008 | 6 figures from Snelson et al., 2008 | |
| tbx2bc144 | Unknown | Unknown | |||
| tbx2bc144/c144; hu10671Tg/hu10671Tg; hu6531Tg/hu6531Tg; nkuasrfp1aTg/nkuasrfp1aTg | Complex | Figure 8 from Tessadori et al., 2021 | Figure 8 from Tessadori et al., 2021 | ||
| tbx2bc144/c144; kj2Tg | Complex | 2 figures from Raymond et al., 2014 | 3 figures from Raymond et al., 2014 | ||
| tbx2bc144/c144; kj9Tg | Complex | 3 figures from Raymond et al., 2014 | 4 figures from Raymond et al., 2014 | ||
| tbx2bc144/c144; kj9Tg; mi2007Tg | Complex | Fig. 6 from Raymond et al., 2014 | 3 figures from Raymond et al., 2014 | ||
| tbx2bc144/c144; mi2007Tg | Complex | ||||
| tbx2bc144/c144; s931Tg | Complex |
1 - 10 of 22
Show
Supplemental Information
- Genotyping protocol
- None
- Tessadori, F., Tsingos, E., Colizzi, E.S., Kruse, F., van den Brink, S.C., van den Boogaard, M., Christoffels, V.M., Merks, R.M., Bakkers, J. (2021) Twisting of the zebrafish heart tube during cardiac looping is a tbx5-dependent and tissue-intrinsic process. eLIFE. 10:
- DuVal, M.G., Allison, W.T. (2018) Photoreceptor Progenitors Depend Upon Coordination of gdf6a, thrβ, and tbx2b to Generate Precise Populations of Cone Photoreceptor Subtypes. Investigative ophthalmology & visual science. 59:6089-6101
- Hocking, J.C., Famulski, J.K., Yoon, K.H., Widen, S.A., Bernstein, C.S., Koch, S., Weiss, O., FORGE Canada Consortium, Agarwala, S., Inbal, A., Lehmann, O.J., Waskiewicz, A.J. (2018) Morphogenetic defects underlie Superior Coloboma, a newly identified closure disorder of the dorsal eye. PLoS Genetics. 14:e1007246
- Choi, T.Y., Khaliq, M., Tsurusaki, S., Ninov, N., Stainier, D.Y.R., Tanaka, M., Shin, D. (2017) Bmp Signaling Governs Biliary-Driven Liver Regeneration in Zebrafish via Tbx2b and Id2a. Hepatology (Baltimore, Md.). 66(5):1616-1630
- Drummond, B.E., Li, Y., Marra, A.N., Cheng, C.N., Wingert, R.A. (2017) The tbx2a/b transcription factors direct pronephros segmentation and corpuscle of Stannius formation in zebrafish. Developmental Biology. 421(1):52-66
- Khuansuwan, S., Clanton, J.A., Dean, B.J., Patton, J.G., Gamse, J.T. (2016) A transcription factor network controls cell migration and fate decisions in the developing zebrafish pineal complex. Development (Cambridge, England). 143(14):2641-50
- Duval, M.G., Oel, A.P., Allison, W.T. (2014) gdf6a is required for cone photoreceptor subtype differentiation and for the actions of tbx2b in determining rod versus cone photoreceptor fate. PLoS One. 9:e92991
- Khuansuwan, S., Gamse, J.T. (2014) Identification of differentially expressed genes during development of the zebrafish pineal complex using RNA sequencing. Developmental Biology. 395(1):144-53
- Mueller, K.P., and Neuhauss, S.C. (2014) Sunscreen for fish: co-option of UV light protection for camouflage. PLoS One. 9(1):e87372
- Raymond, P.A., Colvin, S.M., Jabeen, Z., Nagashima, M., Barthel, L.K., Hadidjojo, J., Popova, L., Pejaver, V.R., and Lubensky, D.K. (2014) Patterning the cone mosaic array in zebrafish retina requires specification of ultraviolet-sensitive cones. PLoS One. 9(1):e85325
1 - 10 of 14
Show