Morpholino Name: MO2-si:ch73-1a9.3
Target: si:ch73-1a9.3 (1)
Sequence:
5' - GGCCTTCTGTAATGTACAGTTATTT - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.