Morpholino Name: | MO1-gata1a | ||||||
---|---|---|---|---|---|---|---|
Target: | gata1a (1) | ||||||
Previous Names: | gata1 MO (1), MO(T)-gata1 (1), MO1-gata1, Gata1 morpholino (1) | ||||||
Add new Alias
Delete Alias:(Including Attributions) |
|||||||
Sequence: |
5' - CTGCAAGTGTAGTATTGAAGATGTC - 3'
|
||||||
(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.) | |||||||
Note: | A translation blocking morpholino targeting gata1. This morpholino sequence was reported with an additional nucleotide in Rhodes et al. 2005 and is correct as displayed here confirmed by author. |