| Morpholino Name: | MO2-tal1 | 
    
        
        | Target: | tal1  (1) | 
    
        
    
        
    
    
    | Previous Names: | SCL E2/I, 
            
                tal1 MO E2/I | 
    | 
    
        Attributions for Alias: {{control.newAlias}}
     
    
        Delete Alias: 
        
    
    (Including Attributions)
    
 | 
    
    
    
        | Sequence: | 
                        5' - AATGCTCTTACCATCGTTGATTTC - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | Originally reported to target the exon/intron boundary of exon 2. Current analysis suggests this boundary to be exon/intron 3. This morpholino is one bp shorter than MO4-tal1, which is reported to hybridize to exon/intron 3. |