CRISPR

CRISPR1-myoc

ID

ZDB-CRISPR-211014-1

Name

CRISPR1-myoc

Previous Names

None

Target

myoc (1)

Sequence

5' - GGTTGCTCGTCTCGTAGGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ucl2	myoc

Expression

Gene expression in Wild Types + CRISPR1-myoc

No data available

Phenotype

Phenotype resulting from CRISPR1-myoc

No data available

Phenotype of all Fish created by or utilizing CRISPR1-myoc

Phenotype	Fish	Conditions	Figures
male organism dmrt1 expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
intestine epithelial cell Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 6 from Atienzar-Aroca et al., 2021
gonad apoptotic process increased process quality, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 9 from Atienzar-Aroca et al., 2021
male organism dvl3a expression decreased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
iris blood vessels Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 5 from Atienzar-Aroca et al., 2021
male organism lef1 expression decreased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
male organism irg1l expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
male organism plpp4 expression decreased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
seminiferous epithelium Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 7 from Atienzar-Aroca et al., 2021
male organism star expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
pharyngeal musculature peripheral region Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 6 from Atienzar-Aroca et al., 2021
corneal epithelium Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 5 from Atienzar-Aroca et al., 2021
lens extracellular space Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 2 from Atienzar-Aroca et al., 2021
male organism sycp3 expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
periocular mesenchyme Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 2 from Atienzar-Aroca et al., 2021
male organism cyp11a1.1 expression decreased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
intestinal bulb enterocyte Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 6 from Atienzar-Aroca et al., 2021
male organism amh expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
whole organism myoc expression decreased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 1 from Atienzar-Aroca et al., 2021
male organism ctnnbip1 expression decreased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
iris stroma Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 5 from Atienzar-Aroca et al., 2021
female sex determination disrupted, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 8 from Atienzar-Aroca et al., 2021
eye epithelial cell Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 5 from Atienzar-Aroca et al., 2021
male organism tuba7l expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
gonad Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 9 from Atienzar-Aroca et al., 2021
male organism dkk1a expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
yolk extracellular space Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 3 from Atienzar-Aroca et al., 2021
male organism grik3 expression increased amount, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 10 from Atienzar-Aroca et al., 2021
retinal ganglion cell Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 5 from Atienzar-Aroca et al., 2021
muscle posterior side Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 4 from Atienzar-Aroca et al., 2021
lens epithelium Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 2 from Atienzar-Aroca et al., 2021
post-vent region integument Ab1-myoc labeling absent, abnormal	myoc^ucl2/ucl2 (AB)	standard conditions	Figure 4 from Atienzar-Aroca et al., 2021
lens extracellular space Ab1-myoc labeling decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 2 from Atienzar-Aroca et al., 2021
whole organism myoc expression decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 1 from Atienzar-Aroca et al., 2021
post-vent region integument Ab1-myoc labeling decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 4 from Atienzar-Aroca et al., 2021
muscle posterior side Ab1-myoc labeling decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 4 from Atienzar-Aroca et al., 2021
periocular mesenchyme Ab1-myoc labeling decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 2 from Atienzar-Aroca et al., 2021
yolk extracellular space Ab1-myoc labeling decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 3 from Atienzar-Aroca et al., 2021
lens epithelium Ab1-myoc labeling decreased amount, abnormal	myoc^ucl2/+ (AB)	standard conditions	Figure 2 from Atienzar-Aroca et al., 2021

Citations