Morpholino

MO1-fam50a

ID

ZDB-MRPHLNO-210309-1

Name

MO1-fam50a

Previous Names

None

Target

Sequence

5' - AGTAAAATCCCGTACATATCTCCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fam50a

Expressed Gene	Anatomy	Figures
cdkn1a	midbrain	Fig. 2 from Lee et al., 2020
her4.1	brain central nervous system	Fig. 2 from Lee et al., 2020
mdm2	midbrain	Fig. 2 from Lee et al., 2020
tp53	midbrain	Fig. 2 from Lee et al., 2020

Phenotype

Phenotype resulting from MO1-fam50a

Phenotype	Fish	Figures
brain EGFP expression decreased amount, abnormal	knu3Tg + MO1-fam50a	Fig. 2 from Lee et al., 2020
brain her4.1 expression decreased amount, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
central nervous system her4.1 expression decreased amount, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
central nervous system EGFP expression decreased amount, abnormal	knu3Tg + MO1-fam50a	Fig. 2 from Lee et al., 2020
ceratobranchial cartilage deformed, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
ceratohyal cartilage deformed, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	zf195Tg + MO1-fam50a	Fig. 3 from Lee et al., 2020
head morphology, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
Meckel's cartilage deformed, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
midbrain apoptotic process increased process quality, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020
palatoquadrate cartilage deformed, abnormal	WT + MO1-fam50a	Fig. 2 from Lee et al., 2020

Phenotype of all Fish created by or utilizing MO1-fam50a

Phenotype	Fish	Conditions	Figures
central nervous system her4.1 expression decreased amount, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
palatoquadrate cartilage deformed, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
ceratobranchial cartilage deformed, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
brain her4.1 expression decreased amount, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
ceratohyal cartilage deformed, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
head morphology, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
midbrain apoptotic process increased process quality, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
Meckel's cartilage deformed, abnormal	WT + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
central nervous system EGFP expression decreased amount, abnormal	knu3Tg + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
brain EGFP expression decreased amount, abnormal	knu3Tg + MO1-fam50a	control	Fig. 2 from Lee et al., 2020
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	zf195Tg + MO1-fam50a	control	Fig. 3 from Lee et al., 2020

Citations