CRISPR

CRISPR1-pdcd11

ID
ZDB-CRISPR-210903-1
Name
CRISPR1-pdcd11
Previous Names
None
Target
Sequence
5' - GGTCTCCCGAGCGGCCTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3478 pdcd11
Expression
Gene expression in Wild Types + CRISPR1-pdcd11
No data available
Phenotype
Phenotype resulting from CRISPR1-pdcd11
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pdcd11
Phenotype Fish Conditions Figures
whole organism Ab7-tgfb1 labeling decreased amount, abnormal pdcd11zf3478/zf3478 chemical treatment by environment: NF-kappaB inhibitor Fig. 3 with image from Yang et al., 2020
cranium malformed, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage increased size, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain microglial cell apoeb expression decreased amount, abnormal pdcd11zf3478/zf3478 chemical treatment by environment: NF-kappaB inhibitor Fig. 3 with image from Yang et al., 2020
whole organism il6 expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with imageFig. 3 with image from Yang et al., 2020
whole organism il1b expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with imageFig. 3 with image from Yang et al., 2020
whole organism tnfa expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with imageFig. 3 with image from Yang et al., 2020
brain macrophage lcp1 expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage vacuolated, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain microglial cell csf1b expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 2 with image from Yang et al., 2020
brain macrophage mfap4.4 expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with imageFig. 3 with imageFig. 6 with image from Yang et al., 2020
brain microglial cell ctsba expression decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 2 with image from Yang et al., 2020
whole organism tgfb1a expression decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 2 with image from Yang et al., 2020
brain microglial cell csf1ra expression decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
chordate embryonic development delayed, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain microglial cell absent, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain il6 expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
yolk syncytial layer tgfb1a expression decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 2 with image from Yang et al., 2020
brain macrophage mfap4.4 expression amount, ameliorated pdcd11zf3478/zf3478 chemical treatment by environment: NF-kappaB inhibitor Fig. 3 with image from Yang et al., 2020
whole organism Ab7-tgfb1 labeling decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 3 with image from Yang et al., 2020
brain microglial cell apoeb expression decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with imageFig. 3 with image from Yang et al., 2020
macrophage cxcr3.1 expression increased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
macrophage cxcr3.2 expression decreased amount, abnormal pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
macrophage tnfa expression increased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage increased size, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage sall1a expression decreased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 2 with image from Yang et al., 2020
brain macrophage tgfbr1a expression decreased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 2 with image from Yang et al., 2020
brain macrophage vacuolated, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage ctsl.1 expression increased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 2 with image from Yang et al., 2020
brain macrophage increased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 1 with image from Yang et al., 2020
brain macrophage tgfbr1b expression decreased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 2 with image from Yang et al., 2020
brain macrophage tlr5a expression increased amount, abnormal pdcd11zf3478/zf3478; gl22Tg standard conditions Fig. 2 with image from Yang et al., 2020
whole organism il6 expression increased amount, abnormal tp53zdf1/zdf1; pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
whole organism il1b expression increased amount, abnormal tp53zdf1/zdf1; pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
whole organism tnfa expression increased amount, abnormal tp53zdf1/zdf1; pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
brain il6 expression increased amount, abnormal tp53zdf1/zdf1; pdcd11zf3478/zf3478 standard conditions Fig. 1 with image from Yang et al., 2020
Citations