CRISPR

CRISPR2-aldh7a1

ID
ZDB-CRISPR-180208-4
Name
CRISPR2-aldh7a1
Previous Names
None
Target
Sequence
5' - GGTACCTGCTCCAAAGAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf2074 aldh7a1
Expression
Gene expression in Wild Types + CRISPR2-aldh7a1
No data available
Phenotype
Phenotype resulting from CRISPR2-aldh7a1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-aldh7a1
Phenotype Fish Conditions Figures
whole organism glutamate(1-) decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Minenkova et al., 2021
whole organism citrate synthase activity decreased process quality, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 5 with image from Minenkova et al., 2021
whole organism NADH dehydrogenase (ubiquinone) activity decreased process quality, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 5 with image from Minenkova et al., 2021
whole organism pyridoxal decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 2 with image from Minenkova et al., 2021
whole organism succinate decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 4 with image from Minenkova et al., 2021
swimming decreased duration, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Zabinyakov et al., 2017
whole organism pipecolic acid increased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 6 with image from Zabinyakov et al., 2017
whole organism fumarate(2-) decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 4 with image from Minenkova et al., 2021
whole organism pyridoxine decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 2 with image from Minenkova et al., 2021
whole organism succinate dehydrogenase (quinone) activity decreased process quality, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 5 with image from Minenkova et al., 2021
regulation of neuronal action potential disrupted, ameliorated aldh7a1zf2074/zf2074 chemical treatment: diazepam, chemical treatment: pyridoxine Fig. 5 with image from Zabinyakov et al., 2017
whole organism pyridoxal 5'-phosphate decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 2 with image from Minenkova et al., 2021
whole organism lactate decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 4 with image from Minenkova et al., 2021
whole organism glutamine decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Minenkova et al., 2021
whole organism malate decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 4 with image from Minenkova et al., 2021
whole organism gamma-aminobutyric acid decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Minenkova et al., 2021
whole organism pyridoxamine 5'-phosphate decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 2 with image from Minenkova et al., 2021
whole organism cytochrome-c oxidase activity decreased process quality, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 5 with image from Minenkova et al., 2021
swimming decreased occurrence, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Zabinyakov et al., 2017
whole organism succinic semialdehyde decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Minenkova et al., 2021
whole organism dead, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 2 with image from Zabinyakov et al., 2017
regulation of neuronal action potential disrupted, abnormal aldh7a1zf2074/zf2074 chemical treatment: phenobarbital Fig. 4 with imageFig. 5 with image from Zabinyakov et al., 2017
whole organism allysine increased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 6 with image from Zabinyakov et al., 2017
whole organism citrate(3-) decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 4 with image from Minenkova et al., 2021
regulation of neuronal action potential disrupted, ameliorated aldh7a1zf2074/zf2074 chemical treatment: phenobarbital, chemical treatment: pyridoxine Fig. 5 with image from Zabinyakov et al., 2017
whole organism isocitrate(3-) decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig 4 with image from Minenkova et al., 2021
regulation of neuronal action potential disrupted, abnormal aldh7a1zf2074/zf2074 control Fig. 4 with imageFig. 5 with image from Zabinyakov et al., 2017
whole organism 4-hydroxybutyrate decreased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 3 with image from Minenkova et al., 2021
regulation of neuronal action potential disrupted, abnormal aldh7a1zf2074/zf2074 chemical treatment: diazepam Fig. 4 with imageFig. 5 with image from Zabinyakov et al., 2017
whole organism 1-piperideine-6-carboxylate increased amount, abnormal aldh7a1zf2074/zf2074 standard conditions Fig. 6 with image from Zabinyakov et al., 2017
regulation of neuronal action potential disrupted, ameliorated aldh7a1zf2074/zf2074 chemical treatment: pyridoxine Fig. 4 with image from Zabinyakov et al., 2017
Citations