CRISPR

CRISPR1-stat4

ID

ZDB-CRISPR-170508-1

Name

CRISPR1-stat4

Previous Names

None

Target

stat4 (1)

Sequence

5' - GGCATCAAACCATGAATCTATGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf2070	stat4

Expression

Gene expression in Wild Types + CRISPR1-stat4

No data available

Phenotype

Phenotype resulting from CRISPR1-stat4

No data available

Phenotype of all Fish created by or utilizing CRISPR1-stat4

Phenotype	Fish	Conditions	Figures
aortic arch 6 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 , Fig. 7 from Meng et al., 2017
aortic arch 3 angioblastic mesenchymal cell tie1 expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 3 constricted, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070}	chemical treatment by environment: trichostatin A	Fig. 7 from Meng et al., 2017
pharynx atrophied, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 vasculogenesis decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 5 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070}	chemical treatment by environment: trichostatin A	Fig. 7 from Meng et al., 2017
whole organism hdac3 expression increased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 5 vasculogenesis decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 4 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070}	chemical treatment by environment: trichostatin A	Fig. 7 from Meng et al., 2017
aortic arch 4 vasculogenesis decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch embryonic blood vessel endothelial progenitor cell etsrp expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 5 angioblastic mesenchymal cell tie1 expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 3 vasculogenesis decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 4 decreased length, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 decreased length, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 decreased length, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 , Fig. 7 from Meng et al., 2017
aortic arch 5 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 , Fig. 7 from Meng et al., 2017
whole organism stat1a expression increased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 6 angioblastic mesenchymal cell tie1 expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 3 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070}	chemical treatment by environment: trichostatin A	Fig. 7 from Meng et al., 2017
aortic arch embryonic blood vessel endothelial progenitor cell tal1 expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 5 constricted, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 constricted, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 angioblastic mesenchymal cell tie1 expression decreased amount, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 from Meng et al., 2017
aortic arch 4 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 , Fig. 7 from Meng et al., 2017
aortic arch 3 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 3 , Fig. 7 from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression amount, ameliorated	stat4^{zf2070/zf2070}	chemical treatment by environment: trichostatin A	Fig. 7 from Meng et al., 2017
aortic arch 6 constricted, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 3 decreased length, abnormal	stat4^{zf2070/zf2070}	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; y1Tg; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; y1Tg; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; y1Tg; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 3 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; y1Tg; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 lacks all parts of type aortic arch 5 blood vessel endothelium, abnormal	stat4^{zf2070/zf2070}; y7Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 3 has fewer parts of type aortic arch 3 blood vessel endothelial cell, abnormal	stat4^{zf2070/zf2070}; y7Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 has fewer parts of type aortic arch 4 blood vessel endothelial cell, abnormal	stat4^{zf2070/zf2070}; y7Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 has fewer parts of type aortic arch 6 blood vessel endothelial cell, abnormal	stat4^{zf2070/zf2070}; y7Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 3 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 blood circulation arrested, abnormal	stat4^{zf2070/zf2070}; zf2071Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 3 constricted, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 decreased length, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 decreased length, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 decreased length, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 4 constricted, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 constricted, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 3 decreased length, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 6 constricted, abnormal	stat4^{zf2070/zf2070}; zf2072Tg	standard conditions	Fig. 2 from Meng et al., 2017
aortic arch 5 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO2-stat1a	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 3 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO2-stat1a	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 4 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO2-stat1a	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 6 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO2-stat1a	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression amount, ameliorated	stat4^{zf2070/zf2070} + MO2-stat1a	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 3 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070} + MO2-stat1b	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 5 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070} + MO2-stat1b	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 6 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070} + MO2-stat1b	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression decreased amount, abnormal	stat4^{zf2070/zf2070} + MO2-stat1b	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 4 angioblast cell differentiation decreased occurrence, abnormal	stat4^{zf2070/zf2070} + MO2-stat1b	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 3 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO3-hdac3	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 4 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO3-hdac3	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression amount, ameliorated	stat4^{zf2070/zf2070} + MO3-hdac3	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 6 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO3-hdac3	standard conditions	Fig. 7 from Meng et al., 2017
aortic arch 5 angioblast cell differentiation occurrence, ameliorated	stat4^{zf2070/zf2070} + MO3-hdac3	standard conditions	Fig. 7 from Meng et al., 2017

Citations