Morpholino

MO2-hand2

ID
ZDB-MRPHLNO-080930-4
Name
MO2-hand2
Previous Names
None
Target
Sequence
5' - CCTCCAACTAAACTCATGGCGACAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hand2
Expressed Gene Anatomy Figures
crestin Fig. 1 with image from Reichenbach et al., 2008
gata4 Fig. 3 with image from Maves et al., 2009
gata5 Fig. 3 with image from Maves et al., 2009
gdnfa Fig. 10 with image from Reichenbach et al., 2008
hand2 Fig. 3 with image from Maves et al., 2009
mef2ca Fig. S7 with image from Hinits et al., 2012
mef2cb Fig. S7 with image from Hinits et al., 2012
myh6 Fig. 4 with image from Maves et al., 2009
myh7 Fig. 4 with image from Maves et al., 2009
myh11a Fig. 1 with image from Reichenbach et al., 2008
myl7 Fig. 4 with image,  Fig. 5 with image from Maves et al., 2009
nkx2.5 Fig. 3 with image from Maves et al., 2009
nppa Fig. 4 with image from Maves et al., 2009
phox2bb Fig. 1 with image from Reichenbach et al., 2008
tal1 Fig. 3 with image from Maves et al., 2009
Phenotype
Phenotype resulting from MO2-hand2
Phenotype Fish Figures
atrium decreased size, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
atrium shape, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cardiac muscle cell organization quality, abnormal WT + MO2-hand2 Fig. S7 with image from Hinits et al., 2012
cardiac muscle cell differentiation disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cardiac ventricle decreased size, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cardiac ventricle shape, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cell migration to the midline involved in heart development delayed, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cell migration to the midline involved in heart development process quality, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
embryonic heart tube elongation disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
enteric nervous system neuron decreased amount, abnormal WT + MO2-hand2 Fig. 2 with image from Reichenbach et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
heart morphology, abnormal AB + MO2-hand2 Fig. 5 with image from Maves et al., 2009
heart development disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart formation disrupted, abnormal WT + MO2-hand2 Fig. S7 with image from Hinits et al., 2012
heart looping disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO2-hand2 Fig. 5 with image from Maves et al., 2009
heart morphogenesis process quality, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart primordium myocardial precursor decreased amount, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart rudiment bifurcated, abnormal WT + MO2-hand2 Fig. S7 with image from Hinits et al., 2012
heart tube aplastic, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
intestine neuron decreased amount, abnormal WT + MO2-hand2 Fig. 2 with image from Reichenbach et al., 2008
intestine smooth muscle cell morphology, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
neural crest cell migration disrupted, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
smooth muscle cell differentiation disrupted, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
Phenotype of all Fish created by or utilizing MO2-hand2
Phenotype Fish Conditions Figures
heart morphogenesis process quality, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac muscle cell differentiation disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac ventricle shape, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart development disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart tube aplastic, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart primordium myocardial precursor decreased amount, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cell migration to the midline involved in heart development process quality, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart morphology, abnormal AB + MO2-hand2 standard conditions Fig. 5 with image from Maves et al., 2009
embryonic heart tube elongation disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
atrium shape, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
atrium decreased size, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 5 with image from Maves et al., 2009
cell migration to the midline involved in heart development delayed, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart looping disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac ventricle decreased size, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
intestine smooth muscle cell morphology, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
intestine neuron decreased amount, abnormal WT + MO2-hand2 standard conditions Fig. 2 with image from Reichenbach et al., 2008
enteric nervous system neuron decreased amount, abnormal WT + MO2-hand2 standard conditions Fig. 2 with image from Reichenbach et al., 2008
heart formation disrupted, abnormal WT + MO2-hand2 standard conditions Fig. S7 with image from Hinits et al., 2012
neural crest cell migration disrupted, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
smooth muscle cell differentiation disrupted, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
heart rudiment bifurcated, abnormal WT + MO2-hand2 standard conditions Fig. S7 with image from Hinits et al., 2012
cardiac muscle cell organization quality, abnormal WT + MO2-hand2 standard conditions Fig. S7 with image from Hinits et al., 2012
heart morphology, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.