Morpholino

MO1-ccdc78

ID
ZDB-MRPHLNO-120904-1
Name
MO1-ccdc78
Previous Names
  • exon 2 morpholino (1)
Target
Sequence
5' - TGTACCTGTGTGGAAATCAGTGTTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccdc78
Expressed Gene Anatomy Figures
ccdc78 Fig. 4,  Fig. S4 from Majczenko et al., 2012
Phenotype
Phenotype resulting from MO1-ccdc78
Phenotype Fish Figures
mechanosensory behavior disrupted, abnormal AB + MO1-ccdc78 Fig. 4,  text only from Majczenko et al., 2012
post-vent region bent, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
skeletal muscle myofibril disorganized, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
skeletal muscle cell has extra parts of type skeletal muscle cell membrane, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
skeletal muscle cell sarcoplasmic reticulum dilated, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
skeletal muscle cell sarcoplasmic reticulum swollen, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
skeletal muscle cell T-tubule dilated, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
swimming disrupted, abnormal AB + MO1-ccdc78 text only from Majczenko et al., 2012
swimming behavior behavioral quality of a process, abnormal AB + MO1-ccdc78 text only from Majczenko et al., 2012
thigmotaxis disrupted, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
whole organism decreased length, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
whole organism decreased size, abnormal AB + MO1-ccdc78 Fig. 4 from Majczenko et al., 2012
Phenotype of all Fish created by or utilizing MO1-ccdc78
Phenotype Fish Conditions Figures
skeletal muscle cell T-tubule dilated, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
skeletal muscle cell sarcoplasmic reticulum dilated, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
skeletal muscle cell sarcoplasmic reticulum swollen, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
post-vent region bent, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
skeletal muscle myofibril disorganized, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
skeletal muscle cell has extra parts of type skeletal muscle cell membrane, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
swimming disrupted, abnormal AB + MO1-ccdc78 standard conditions text only from Majczenko et al., 2012
whole organism decreased length, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
thigmotaxis disrupted, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
mechanosensory behavior disrupted, abnormal AB + MO1-ccdc78 standard conditions Fig. 4,  text only from Majczenko et al., 2012
whole organism decreased size, abnormal AB + MO1-ccdc78 standard conditions Fig. 4 from Majczenko et al., 2012
swimming behavior behavioral quality of a process, abnormal AB + MO1-ccdc78 standard conditions text only from Majczenko et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.