Morpholino

MO1-gfi1aa

ID

ZDB-MRPHLNO-090106-5

Name

MO1-gfi1aa

Previous Names

MO1-gfi1.1
MO1-gfi1a

Target

gfi1aa (1)

Sequence

5' - GTAAACATGCCGAGGTCATTTTTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gfi1aa

Expressed Gene	Anatomy	Figures
etsrp	posterior lateral plate mesoderm	Fig. S3 from Wei et al., 2008
fli1	cardiovascular system posterior lateral plate mesoderm	Fig. S3 from Wei et al., 2008
gata1a	hematopoietic multipotent progenitor cell	Fig. 3 from Wei et al., 2008
ikzf1	ventral wall of dorsal aorta	Fig. 5 from Cooney et al., 2013
irf2bp2a	neutrophil	Fig 5 from Gao et al., 2021
itga2b	whole organism	Fig. 5 from Cooney et al., 2013
kdrl	cardiovascular system posterior lateral plate mesoderm	Fig. S3 from Wei et al., 2008
lmo2	anterior lateral mesoderm hematopoietic multipotent progenitor cell	Fig. 3 from Wei et al., 2008
mpx	neutrophil	Fig 4 from Gao et al., 2021
myb	hematopoietic multipotent progenitor cell ventral wall of dorsal aorta	Fig. 5 from Cooney et al., 2013 Fig. 3 from Wei et al., 2008
pax2a	midbrain hindbrain boundary neuron optic stalk posterior lateral plate mesoderm pronephric duct	Fig. S3 from Wei et al., 2008
rag1	thymus	Fig. 5 from Cooney et al., 2013
runx1	ventral wall of dorsal aorta	Fig. 5 from Cooney et al., 2013
tal1	anterior lateral mesoderm hematopoietic multipotent progenitor cell	Fig. 3 from Wei et al., 2008

Phenotype

Phenotype resulting from MO1-gfi1aa

Phenotype	Fish	Figures
erythroid lineage cell hemoglobin complex decreased amount, abnormal	WT + MO1-gfi1aa	Fig. 4 from Cooney et al., 2013
erythroid progenitor cell decreased amount, abnormal	la781Tg + MO1-gfi1aa	Fig. 3 from Cooney et al., 2013
hematopoietic progenitor cell differentiation decreased functionality, abnormal	la781Tg + MO1-gfi1aa	Fig. 3 from Cooney et al., 2013
myeloid lineage restricted progenitor cell increased amount, abnormal	la781Tg + MO1-gfi1aa	Fig. 3 from Cooney et al., 2013
neutrophil mpx expression increased amount, abnormal	AB + MO1-gfi1aa	Fig 4 from Gao et al., 2021
neutrophil irf2bp2a expression increased amount, abnormal	rj30Tg/rj30Tg + MO1-gfi1aa	Fig 5 from Gao et al., 2021
neutrophil negative regulation of gene expression decreased process quality, abnormal	rj30Tg/rj30Tg + MO1-gfi1aa	Fig 5 from Gao et al., 2021
neutrophil differentiation increased frequency, abnormal	AB + MO1-gfi1aa	Fig 4 from Gao et al., 2021
thrombocyte increased amount, abnormal	la2Tg + MO1-gfi1aa	Fig. 5 from Cooney et al., 2013

Phenotype of all Fish created by or utilizing MO1-gfi1aa

Phenotype	Fish	Conditions	Figures
neutrophil negative regulation of gene expression decreased process quality, abnormal	rj30Tg/rj30Tg + MO1-gfi1aa	standard conditions	Fig 5 from Gao et al., 2021
neutrophil irf2bp2a expression increased amount, abnormal	rj30Tg/rj30Tg + MO1-gfi1aa	standard conditions	Fig 5 from Gao et al., 2021
neutrophil differentiation increased frequency, abnormal	AB + MO1-gfi1aa	standard conditions	Fig 4 from Gao et al., 2021
neutrophil mpx expression increased amount, abnormal	AB + MO1-gfi1aa	standard conditions	Fig 4 from Gao et al., 2021
erythroid lineage cell hemoglobin complex decreased amount, abnormal	WT + MO1-gfi1aa	standard conditions	Fig. 4 from Cooney et al., 2013
thrombocyte increased amount, abnormal	la2Tg + MO1-gfi1aa	standard conditions	Fig. 5 from Cooney et al., 2013
hematopoietic progenitor cell differentiation decreased functionality, abnormal	la781Tg + MO1-gfi1aa	standard conditions	Fig. 3 from Cooney et al., 2013
myeloid lineage restricted progenitor cell increased amount, abnormal	la781Tg + MO1-gfi1aa	standard conditions	Fig. 3 from Cooney et al., 2013
erythroid progenitor cell decreased amount, abnormal	la781Tg + MO1-gfi1aa	standard conditions	Fig. 3 from Cooney et al., 2013
neutrophil regulation of ubiquitin protein ligase activity decreased process quality, abnormal	irf2bp2a^{zf3610/zf3610} + MO1-gfi1aa	standard conditions	Fig 4 from Gao et al., 2021
neutrophil proteasomal protein catabolic process decreased process quality, abnormal	irf2bp2a^{zf3610/zf3610} + MO1-gfi1aa	standard conditions	Fig 4 from Gao et al., 2021
neutrophil mpx expression amount, ameliorated	irf2bp2a^{zf3610/zf3610} + MO1-gfi1aa	standard conditions	Fig 4 from Gao et al., 2021
erythroid lineage cell hemoglobin complex agenesis, abnormal	WT + MO1-gfi1aa + MO1-gfi1b	standard conditions	Fig. 4 from Cooney et al., 2013

Citations