Morpholino

MO1-hsf1

ID
ZDB-MRPHLNO-070426-1
Name
MO1-hsf1
Previous Names
None
Target
Sequence
5' - CACGGAGAGTTTAGTGATGATTTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsf1
Phenotype
Phenotype resulting from MO1-hsf1
Phenotype Fish Figures
brain hsf1 expression absent, abnormal WT + MO1-hsf1 Fig. 5 from Kashyap et al., 2014
eye decreased circumference, abnormal WT + MO1-hsf1 Fig. 6 from Kashyap et al., 2014
eye decreased diameter, abnormal WT + MO1-hsf1 Fig. 2 from Evans et al., 2007
eye decreased size, abnormal WT + MO1-hsf1 Fig. 1Fig. 6text only from Evans et al., 2007
lens decreased size, abnormal WT + MO1-hsf1 Fig. 3Fig. 6 from Evans et al., 2007
lens immature, abnormal WT + MO1-hsf1 Fig. 3 from Evans et al., 2007
lens structure, abnormal WT + MO1-hsf1 Fig. 6 from Evans et al., 2007
pupil decreased diameter, abnormal WT + MO1-hsf1 Fig. 2 from Evans et al., 2007
retina hsf1 expression absent, abnormal WT + MO1-hsf1 Fig. 5 from Kashyap et al., 2014
retina decreased size, abnormal WT + MO1-hsf1 Fig. 3 from Evans et al., 2007
retina disorganized, abnormal WT + MO1-hsf1 Fig. 3 from Evans et al., 2007
retina structure, abnormal WT + MO1-hsf1 Fig. 6 from Evans et al., 2007
retinal ganglion cell decreased amount, abnormal WT + MO1-hsf1 Fig. 6 from Evans et al., 2007
whole organism snai2 expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism hsp90aa1.2 expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism snai1b expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism cdh1 expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism foxd3 expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism hsp70l expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism hsph1 expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
whole organism tfap2a expression decreased amount, abnormal WT + MO1-hsf1 Fig. 6 with image from Eroglu et al., 2014
Phenotype of all Fish created by or utilizing MO1-hsf1
Phenotype Fish Conditions Figures
whole organism tfap2a expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
whole organism snai2 expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
eye decreased diameter, abnormal WT + MO1-hsf1 standard conditions Fig. 2 from Evans et al., 2007
response to heat disrupted, abnormal WT + MO1-hsf1 heat shock Fig. 5 from Evans et al., 2007
retina structure, abnormal WT + MO1-hsf1 standard conditions Fig. 6 from Evans et al., 2007
lens immature, abnormal WT + MO1-hsf1 standard conditions Fig. 3 from Evans et al., 2007
brain hsf1 expression absent, abnormal WT + MO1-hsf1 control Fig. 5 from Kashyap et al., 2014
whole organism hspa8 expression amount, ameliorated WT + MO1-hsf1 heat exposure Fig. 5 from Gong et al., 2019
lens structure, abnormal WT + MO1-hsf1 standard conditions Fig. 6 from Evans et al., 2007
lens decreased circumference, abnormal WT + MO1-hsf1 chemical treatment by environment: ethanol Fig. 6 from Kashyap et al., 2014
whole organism hsp90aa1.2 expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
retina decreased size, abnormal WT + MO1-hsf1 standard conditions Fig. 3 from Evans et al., 2007
retina hsf1 expression absent, abnormal WT + MO1-hsf1 control Fig. 5 from Kashyap et al., 2014
whole organism hsp70l expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
whole organism foxd3 expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
pupil decreased diameter, abnormal WT + MO1-hsf1 standard conditions Fig. 2 from Evans et al., 2007
whole organism cdh1 expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
eye decreased size, abnormal WT + MO1-hsf1 standard conditions Fig. 1Fig. 6text only from Evans et al., 2007
retinal ganglion cell decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 from Evans et al., 2007
eye decreased circumference, abnormal WT + MO1-hsf1 chemical treatment by environment: ethanol Fig. 6 from Kashyap et al., 2014
lens decreased size, abnormal WT + MO1-hsf1 standard conditions Fig. 3Fig. 6 from Evans et al., 2007
whole organism hsph1 expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
eye decreased circumference, abnormal WT + MO1-hsf1 control Fig. 6 from Kashyap et al., 2014
whole organism snai1b expression decreased amount, abnormal WT + MO1-hsf1 standard conditions Fig. 6 with image from Eroglu et al., 2014
retina disorganized, abnormal WT + MO1-hsf1 standard conditions Fig. 3 from Evans et al., 2007
Citations