| Morpholino Name: |
MO1-slc4a1a |
| Target:
|
slc4a1a (1)
|
|
Sequence:
|
5' - TGGTTCTATTGTTTGATACTCACA - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
Splice-blocking morpholino. This morpholino contains three mismatches from the sequence of slc4a1a 5′-"TG"GTTCTATTGT"T"TGATACTCACA-3′. However, the authors found that it was effective in knocking down slc4a1a. |