| Morpholino Name: |
MO1-abcc8 |
| Target:
|
abcc8 (1)
|
|
Previous Names:
|
exon 6 (1),
SB (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - GGACCCTGAATATGTAACAGCAAAA - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
Targets abcc8 when blasted in VEGA (OTTDARG00000035863). |