| Morpholino Name: |
MO1-dio3a |
| Target:
|
dio3a (1)
|
|
Previous Name:
|
dio3a UTR MO (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - GCGCGACGCTCCGCTTCCCTTTTAT - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
Translation-blocking MO, targets the 5'UTR. |