| Morpholino Name: |
MO2-hs3st1l1 |
| Target:
|
hs3st1l1 (1)
|
|
Previous Name:
|
Splice-blocking 3-OST-7 MO2 (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - CACATCTGGAAGACACAAGAGAGAG - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|