Morpholino Name: | MO2-calcrla | ||||||
---|---|---|---|---|---|---|---|
Target: | calcrla (1) | ||||||
Previous Name: | crlr-MO2 (1) | ||||||
Add new Alias
Delete Alias:(Including Attributions) |
|||||||
Sequence: |
5' - TGTACTAATGTGTTGTGTCTACCTC - 3'
|
||||||
(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.) | |||||||
Note: | Morpholino sequence reported in ZDB-PUB-080311-8 includes a duplicated internal CT not found in the genomic sequence (TGTACTAATGTGTTGTGTCTCTACCTC). The redundant CT has been removed from MO2-calcrla. |