| Morpholino Name: | 
        MO1-adcyap1b | 
    
    
        
        | Target:
         | 
        
            
                    
                        adcyap1b  (1)
                    
            
         | 
    
    
        
    
    
        
    
    | 
        Previous Name:
        
     | 
    
            
            
                PACAP2 UTR (1)
            
                
        
     | 
    
        
    
        Attributions for Alias: {{control.newAlias}}
    
    
    
 
    
        Delete Alias: 
        
    
    (Including Attributions)
    
  
     | 
    
    
    
        | 
            Sequence:
         | 
        
            
                
                     
                        5' - GAAATGCTGTTGGAATGCGACTCGGG - 3'
                        
                     
                    
                
                
            
         | 
    
    
    
        |   | 
        
            
                
                    (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.)
                
            
         | 
    
    
    
        | Note: | 
        The published sequence for this morpholino (GAAATGCTGTTGGAATGCGACTCGGG) has an extra nucleotide when compared to sequences for adcyap1b (PACAP2) in the sequence databanks. |