| Morpholino Name: |
MO2-gata1a |
| Target:
|
gata1a (1)
|
|
Previous Names:
|
MO(S)-gata1 (1),
MO2-gata1,
gata1 splice MO (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - GTTTGGACTCACCTGGACTGTGTCT - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
A splice blocking morpholino targeting the first exon/intron boundary of gata1. |