CRISPR Name:	CRISPR8-ripply3
Target:	ripply3 (1)
Source:
Target Sequence:	5' - GGAACTAGCCACATTACACA - 3'
	(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note:	The first "G" was likely added to improve binding. This CRISPR targets regulatory region of ripply3 which is in an intron of ttc3.