| CRISPR Name: | CRISPR2-cct2 | 
    
        
        | Target: | cct2  (1) | 
    
        
    
    
        
    
    | Previous Name: | sgRNA02 (1) | 
    | 
    
        Attributions for Alias: {{control.newAlias}}
     
    
        Delete Alias: 
        
    
    (Including Attributions)
    
 | 
    
    
        
            | Source: |  | 
    
    
        | Target Sequence: | 
                        5' - GGTGCTGGCACAGACCGTCA - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | An additional "G" was added at the beginning. This CRISPR also contains a polymorphism (A/G position 1194) found in the TL strain. |