| CRISPR Name: |
CRISPR9-flt1 |
| Target:
|
flt1 (1)
|
|
Previous Name:
|
sgRNAflt1E11#5 (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Source:
|
|
|
Target Sequence:
|
5' - GGATGGTCAAGATGGGATTGT - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
This CRISPR was created using the DR274 vector for sgRNA cloning and IVT. This vector requires the first two nucleotides to be Gs as it is transcribed by T7 promoter. The first G is a mismatch with the flt1 sequence in Ensembl. |