Morpholino

MO3-dmrt2b

ID
ZDB-MRPHLNO-190514-1
Name
MO3-dmrt2b
Previous Names
None
Target
Sequence
5' - CTTTCTTACCCTGTTGATGAGAACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dmrt2b
Phenotype
Phenotype resulting from MO3-dmrt2b
Phenotype Fish Figures
auditory capsule morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 1 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 1 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 2 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 4 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 4 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 5 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 5 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratohyal cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
ceratohyal cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
ceratohyal cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratohyal cartilage cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S5 from Li et al., 2018
ethmoid cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
head decreased size, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
hyosymplectic cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
hyosymplectic cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
mandibular arch skeleton decreased size, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
mandibular arch skeleton morphology, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
Meckel's cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
Meckel's cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
palatoquadrate cartilage EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S5 from Li et al., 2018
palatoquadrate cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
palatoquadrate cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
palatoquadrate cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
parachordal cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
parachordal cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
pharyngeal arch ab1-smad labeling decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 5 with image from Li et al., 2018
pharyngeal arch mCherry expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b Fig. 5 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b Fig. 3 with imageFig. 5 with image from Li et al., 2018
pharyngeal arch cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S5 from Li et al., 2018
pharyngeal arch cranial neural crest cxcl12b expression decreased amount, abnormal TU + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest EGFP expression decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest hand2 expression decreased amount, abnormal TU + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 1 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S6 from Li et al., 2018
pharyngeal arch 1 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S6 from Li et al., 2018
pharyngeal arch 2 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 2 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 2 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 neural crest cell shape, abnormal ioz22Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 3 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 4 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 5 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 6 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal pouch bmper expression increased amount, abnormal TU + MO3-dmrt2b Fig. 5 with image from Li et al., 2018
trabecula cranii decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
whole organism dmrt2b expression decreased amount, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
Phenotype of all Fish created by or utilizing MO3-dmrt2b
Phenotype Fish Conditions Figures
head decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
whole organism dmrt2b expression decreased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
ceratobranchial 4 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 4 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ethmoid cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
mandibular arch skeleton decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
ceratobranchial 5 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
Meckel's cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
hyosymplectic cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
trabecula cranii decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
auditory capsule morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
Meckel's cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
parachordal cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
hyosymplectic cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratohyal cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 2 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
palatoquadrate cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
mandibular arch skeleton morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
pharyngeal arch cranial neural crest cxcl12b expression decreased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest hand2 expression decreased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal pouch bmper expression increased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
ceratobranchial 1 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 1 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 5 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
parachordal cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
pharyngeal arch 2 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch 2 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 neural crest cell shape, abnormal ioz22Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch ab1-smad labeling decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
pharyngeal arch 1 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S6 from Li et al., 2018
palatoquadrate cartilage EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S5 from Li et al., 2018
pharyngeal arch cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S5 from Li et al., 2018
palatoquadrate cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
palatoquadrate cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
ceratohyal cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 3 with imageFig. 5 with image from Li et al., 2018
ceratohyal cartilage cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S5 from Li et al., 2018
pharyngeal arch 2 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S6 from Li et al., 2018
ceratohyal cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest EGFP expression decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 6 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 4 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 3 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 1 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 5 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
pharyngeal arch mCherry expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
Citations