Morpholino

MO2-kat7b

ID
ZDB-MRPHLNO-180731-1
Name
MO2-kat7b
Previous Names
None
Target
Sequence
5' - CATGTTCCCTCCGATAAATCCAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kat7b
Phenotype
Phenotype resulting from MO2-kat7b
Phenotype Fish Figures
blood accumulation yolk, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
blood accumulation trunk, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
brain hemorrhagic, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
caudal vein blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
dorsal aorta blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
endothelial cell flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
endothelial cell kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
intersegmental vessel blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO2-kat7b Fig. 11Fig. 13 from Yan et al., 2018
subintestinal vein malformed, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12Fig. 15 from Yan et al., 2018
whole organism kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
whole organism kdr expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
whole organism flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
whole organism kat7b expression decreased amount, abnormal y7Tg + MO2-kat7b Fig. 11 from Yan et al., 2018
Phenotype of all Fish created by or utilizing MO2-kat7b
Phenotype Fish Conditions Figures
whole organism kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
endothelial cell flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
endothelial cell kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
whole organism flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
whole organism kdr expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
whole organism kat7b expression decreased amount, abnormal y7Tg + MO2-kat7b standard conditions Fig. 11 from Yan et al., 2018
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO2-kat7b standard conditions Fig. 11Fig. 13 from Yan et al., 2018
subintestinal vein malformed, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
blood accumulation yolk, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
blood accumulation trunk, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
dorsal aorta blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
caudal vein blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
brain hemorrhagic, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
intersegmental vessel blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12Fig. 15 from Yan et al., 2018
Citations